A rovA-lacZ fusion demonstrated repression of rovA by RovM. EMSA showed RovM binding to rovA. DNase I footprinting confirmed this binding and localized the RovM binding site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| ATCGTTGATACATCATTTTTTCTAAAGAATTGCT | YPK_1876 |
|
repressor | not specified |