The amfT transcription start site was identified by S1 protection assay. A sequence matching the BldD consensus binding site was identified in the amfT promoter. EMSA confirmed that BldD binds to the amfT promoter. S1 protection assays revealed that overproduction of bldD markedly repressed amfT promoter activity.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| AGTGACTATGGGCACCGCTCATC | amfT, |
|
repressor | not specified |