UVC induction was shown with RT-PCR, although not in a LexA1- mutant. Palindromic sequences were discovered with RSAT. EMSA competition assays with each of the putative motifs showed that TTGTA-N10-TACAA was likely the binding site for LexA2.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TTGTAATTATACTTGTACAA | LIC12654, |
|
repressor | dimer |