Ad-hoc quantitative phenotype observation, primer extension, and lacZ assays showed that CRP represses the cyaA gene. Primer extension, EMSA, and DNase I footprinting determined the CRP binding site of the cyaA gene.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| GGCAAGGTGTTAGATTGATCACGTTTCCAGCA | cyaA, |
|
repressor | not specified |