EMSA using the vfr promoter identified specific Vfr binding. In vitro transcription assays determined Vfr and cyclic AMP are required to activate vfr. DNase I footprinting localized the Vfr promoter region which contained the binding site. Beta-gal assays verified this cAMP dependence and Vfr mediated regulation.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| AGTACGGGATCACAGTCCTGATAGCTGCGTCG | vfr, |
|
activator | not specified |