Alignment of pchDCBA, pchEFGHI, and fptA promoter regions identified a PchR consensus . pchD-lacZ fusion with progressive deletions in the promoter of the wild-type P. aeruginosa and pyochelin mutant strains demonstrated that this putative binding site is important for pchD expression activation by PchR. Site-directed mutagenesis combined with pchD-lacZ fusion verified PchR as a direct activator of pchD expression. pchR-lacZ fusion assay demonstrated that the pchR expression levels were lower after site-directed mutagenesis, demonstrating the role of PchR as an autorepressor. EMSA with the pchR-pchD intergenic region confirmed binding of PchR to the PchR-box.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA | pchD, |
|
activator | not specified | |
| CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA | pchR, |
|
repressor | not specified |