Primer extension and S1 nuclease experiments identified fur is transcribed from two independent promoters. DNase I footprinting analysis showed that Fur binds to two regions in the fur upstream region with different affinities. Visual inspection of the protected region identified two Fur box-like sequences with seven and eight mismatches from the E.coli Fur box consensus.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| ATATTTTATAAAAGCGAACGATAATCATACGATTAAGC | fur, |
|
repressor | not specified | |
| CGTATTATAACGTCTATTGTTTTACA | fur, |
|
not specified | dimer |