Repression of the PatzR promoter by AtzR was shown through in-vitro transcription in the presence of increased concentrations of His-tagged AtzR. Higher AtzR concentration was required when the ABS secondary site was deleted. EMSAs showed that AtzR binds the PatzR promoter and that it competes with sigma-N for binding. This was further confirmed by DNAse footprinting.
The paper reports that TF forms complex with other proteins for binding with reported sites.
AtzR and Sigma-N compete for binding, leading to PatzR repression.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TGGTGCCGATCCGGCACC | orf99, |
|
repressor | tetramer | |
| CGCACTTGACTGCCGCCTTTTTCCGACC |
|
not specified | tetramer |