Sites were identified with a PSSM search with the known LexA E. coli motif in the promoters of integron integrases from several classes and their position relative to transcriptional and translational start sites validated through multiple sequence alignment. Binding of LexA to the V. parahaemolyticus intIA site was validate through EMSA and its effect on the expression of the integrase gene was assessed through RT-PCR, comparing lexA mutant to wild-type.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| ACCTGTATAAATAAACAGAC | VP1865 |
|
repressor | dimer |