DNase I footprinting showed that manganese-activated Mur binds to the predicted Mur binding site in the mntA promoter. EMSA analysis verified manganese-dependent binding of Mur to mntA since the affinity of Mur to its target site was 60-fold lower in the absence of manganese.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TGCAAATGCTTCTCATTTGCA |
|
not specified | dimer |