Site directed mutagenesis in conjunction with beta-gal report assay demonstrated Zur-mediated regulation of yciC. EMSA was used to confirm binding.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| AAATCGTAATCATTCTATTTT | yciC, |
|
repressor | not specified | |
| AAATCGTAACAATTACGTTTT | yciC, |
|
repressor | not specified |