(1) Determination of binding by primer exension assay. (2) Determination of regulation by beta-gal assay. Site-directed mutagenesis of weak -10 promoter to consensus sequence allows transcription in absence of FNR.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| AAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTATT | pepT, |
|
activator | dimer |