abiEi and abiEii were shown to be bicistronic by examination of RT-PCR transcripts and beta-galactosidase assays with truncated intergenic regions that revealed the presence of an active promoter. AbiEi was shown to repress its own transcription through beta-gal assays. Visual inspection of the abiEi promoter revealed a perfect 11 bp palindrome TGTTGCTTTTA-N27-TAAAAGCAACA. EMSA and beta-gal assays combined with site-directed mutagenesis showed that both ends of this palindrome are required for AbiEi binding. However, the evidence suggests that AbiEi binds as a monomer, independently to each to each 23 bp half site, since deletion of either does not completely eliminate repression, with some synergistic activity upon binding of two monomers.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TGTTGCTTTTATACCACAAATAT | abiGI, abiGII, |
|
repressor | monomer | |
| TGTTGCTTTTACACTACAATTTT | abiGI, abiGII, |
|
repressor | monomer |