RNase protection assay used RNA from the wild type MGAS5005 and covR mutant strains showed that CovR represses rivR expression about threefold. Visual sequence inspection discovered a sequence ATTARA, which is consistent with all CovR binding sites. DNase I footprinting confirmed two CovR binding sites, both included the predicted sequence, on the rivR gene. In vitro transcription using GAS RNA polymerase and sigma factor showed that CovR alone represses rivR.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TATATAGGATTATACAATTTAAT | M5005_Spy_0186, |
|
repressor | not specified | |
| GAGAGAAAAATTACATTGTTAGATTATTATTTGGAA | M5005_Spy_0186, |
|
repressor | not specified |