EMSA determined that Fur binds to the OPI(frpB) promoter. Increasing Fur concentration showed a 10-fold decrease in Fur affinity to the OPI(frpB) operator. Multiple Sequence alignment of Fur binding sites identified a consensus sequence. •OH footprinting determined the binding sequence in the OPI(frpB) promoter.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type | 
|---|---|---|---|---|---|
| TTTTAATAATAATTATCATACTAT | HPG27_830, |  | repressor | dimer |