RNA-seq analysis using mRNA from the wild-type and fur mutant strains identified genes regulated by Fur in S. piezotolerans WP3. qPCR validated the RNA-seq results. EMSA confirmed specific binding of Fur to three promoters containing predicted Fur binding sites.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| AAATGAGATTTGTTCTCAAAC | swp_3277 |
|
repressor | not specified | |
| AGATAAGAATAATTATCATTT | swp_4456, |
|
repressor | not specified |