| Binding site | Location | Publication | Experimental techniques used | Curation |
|---|---|---|---|---|
| TTCGCGTTTCGACTTGCGGCTTCG | - [2163968, 2163991] | 21335458 |
|
1129 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description |
|---|---|---|
| BP1026B_RS27290 | BP1026B_RS27290 | type III secretion protein |
| BP1026B_RS27295 | BP1026B_RS27295 | type III secretion protein HpaP |
| ssaR | BP1026B_RS27285 | EscR/YscR/HrcR family type III secretion system export apparatus protein |
| BP1026B_RS27280 | BP1026B_RS27280 | EscS/YscS/HrcS family type III secretion system export apparatus protein |
| BP1026B_RS27275 | BP1026B_RS27275 | hypothetical protein |