| Binding site | Location | Publication | Experimental techniques used | Curation |
|---|---|---|---|---|
| TTCGCAAGGCGGGCGAGGAGTTCGG | + [1435639, 1435663] | 15225308 |
|
1121 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description |
|---|---|---|
| RS_RS06765 | RS_RS06765 | type III effector protein |