Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029670
Genome
Vibrio cholerae - NC_012667.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATTGAAAAATAAAAATAAGT + [71555, 71576] 19276207 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details PSSM site search (ECO:0005659) - 924

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_000066 VCD_000067
Gene Locus tag Description
VCD_000066 VCD_000066 nitric oxide dioxygenase
VCD_000067 VCD_000067 anaerobic nitric oxide reductase transcription regulator