Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000230d0
Genome
Vibrio cholerae - NC_009457.1
TF
RpoE [UniProtKB:Q9KPA6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGAACTCATTGCCACATTGCCTCTCTAA - [2462240, 2462267] 24733097 Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Visual sequence inspection (nan) - 834

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... epsC gspD epsE epsF epsG epsH epsI epsJ epsK epsL epsM epsN hslO
Gene Locus tag Description
epsC VC0395_A2307 general secretion pathway protein C
gspD VC0395_A2306 general secretion pathway protein D
epsE VC0395_A2305 general secretion pathway protein E
epsF VC0395_A2304 general secretion pathway protein F
epsG VC0395_A2303 general secretion pathway protein G
epsH VC0395_A2302 general secretion pathway protein H
epsI VC0395_A2301 general secretion pathway protein I
epsJ VC0395_A2300 general secretion pathway protein J
epsK VC0395_A2299 general secretion pathway protein K
epsL VC0395_A2298 general secretion pathway protein L
epsM VC0395_A2297 cholera toxin secretion protein EpsM
epsN VC0395_A2296 general secretion pathway protein N
hslO VC0395_A2309 Hsp33-like chaperonin