| Binding site | Location | Publication | Experimental techniques used | Curation |
|---|---|---|---|---|
| TAAATTTTCCCGCTCCGGCCTCGT | + [2648528, 2648551] | 12207696 |
|
801 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.