| Binding site | Location | Publication | Experimental techniques used | Curation | 
|---|---|---|---|---|
| TTTTTTACAAAGAAAATCAATAATTTA | - [75468, 75494] | 11694511 | 
	      
          
 | 
        757 | 
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.