| Binding site | Location | Publication | Experimental techniques used | Curation |
|---|---|---|---|---|
| TGCTGTATATACTCACAGCA | + [4255091, 4255110] | 16264194 |
|
68 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.