Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000080
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
LexA [UniProtKB:Q87KN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGCTGTATGTGTATACAGTAG + [1339301, 1339322] 22305460 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - 1

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP1264 VP1265
Gene Locus tag Description
VP1264 VP1264 hypothetical protein
VP1265 VP1265 hypothetical protein