IscR
UniProtKB: Q9HXI7 regulon and binding site collection of Pseudomonas aeruginosa PAO1
For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show [binding sites], [positively-regulated genes], [negatively-regulated genes], [both positively and negatively regulated genes], [genes with unspecified type of regulation].
| Genome | TF | TF conformation | Site Sequence | Site Location | Experimental Techniques | Gene Regulation | Curation | PMID |
|---|---|---|---|---|---|---|---|---|
| NC_002516.2 | Q9HXI7 | N/A | AAACCCGAGGTTTTCGCTCGGGTAAA | + [2860360, 2860385] | EMSA (ECO:0001807), Visual sequence inspection (nan), Northern blot (ECO:0005653) | tpx (PA2532) | 571 | 22609922 |
| NC_002516.2 | Q9HXI7 | N/A | AATCCTGAGTAATTTGATCGGTCTT | + [4272727, 4272751] | qRT-PCR [RNA] (ECO:0001808), Visual sequence inspection (nan) | iscR (PA3815), iscS (PA3814), iscU (PA3813), iscA (PA3812), hscB (PA3811), hscA (PA3810), fdx2 (PA3809), PA3808 (PA3808) | 774 | 24466226 |
| NC_002516.2 | Q9HXI7 | N/A | ATAGTTGACCTAATTACTCGGATAA | + [4272702, 4272726] | qRT-PCR [RNA] (ECO:0001808), Visual sequence inspection (nan) | iscR (PA3815), iscS (PA3814), iscU (PA3813), iscA (PA3812), hscB (PA3811), hscA (PA3810), fdx2 (PA3809), PA3808 (PA3808) | 774 | 24466226 |